METABOLISM LECTURE
  Nucleotide
 

Nucleotide Structure.  Nucleotides are essential for many life processes. What are the functions of nucleotides? What is nucleotide structure? Explain with the 3 major groups that should be in this structure! Which positions in a purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

 

Biosynthesis of nucleotides. The pathways for the biosynthesis of nucleotides fall into two classes: de novo pathways and salvage pathways. Please explain both of biosynthesis.

 

 

Purine and Pirimidine. Nucleotides have three characteristic components: a nitrogenous base, a pentose, a phosphate  The nitrogenous bases are derivatives of two parent compounds, pyrimidine and purine. Please describe it clearly. Please write Purine Catabolism (from AMP à Guanine). What do you know about Lesch-Nyhan syndrome?

 

 

DNA and RNA. The fundamental unit of information in living systems is the gene. A gene can be defined biochemically as a segment of DNA (or, in a few cases, RNA). What do you know about DNA and RNA? Distinction between DNA Structure and RNA! Figure the structures and names of the four major deoxyribonucleotides (deoxyribonucleoside 5-monophosphates and the four major ribonucleotides (ribonucleoside 5-monophosphates. Structure Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the helical structure of a long and fully base-paired (except at the end) hairpin in RNA different from that of a similar hairpin in DNA?

 

 

Certain DNA Sequences Adopt Unusual Structures. What do you know about palindrome? hairpin or cruciform (cross-shaped) structures ? Please figure it clearly!

Base Sequence of Complementary DNA Strands. One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3’). Write the base

sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?

 

 

Central dogma of molecular biology.  There are three major processes in the cellular utilization of genetic information. Please explain it clearly. Where it happen for each processes? Including regulatory which involve!

 

 

DNA Sequencing. There are two methods for sequencing of DNA. Please explain both of them. What dou know about fingerprint DNA? What is it for?

Crime case:

Police ask you to identicate a murder by skin cells. After blotting you get like the figure below. Please write the DNA sequence of the murder.





DNA replication. What do you now abput DNA replication? As and scientist, you wanna make an insulin hormone. From your research, you’ve get the DNA sequences which involve to make insulin hormone. What are the next step of your research to get an insulin hormone? What do you need to replicate this DNA (including the equipment)? Please explain clearly! What do you know about DNA ligase?

 

DNA Repair. A cell generally has only one or two sets of genomic DNA. Damaged proteins and RNA molecules can be quickly replaced by using information encoded in the DNA, but DNA molecules themselves are irreplaceable. Maintaining the integrity of the information in DNA is a cellular imperative, supported by an elaborate set of

DNA repair systems. What do you know about DNA repair? How is the mechanism of it?

 

 

Coding of a Polypeptide by Duplex DNA. The template strand of a segment of double-helical DNA contains the sequence (5)CTTAACACCCCTGACTTCGCGCCGTCG(3)

a.      What is the base sequence of the mRNA that can be transcribed from this strand?

b.      What amino acid sequence could be coded by the mRNA in (a), starting from the 5_ end?

c.      If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

     



 
  Today, there have been 4 visitors (6 hits) on this page!  
 
This website was created for free with Own-Free-Website.com. Would you also like to have your own website?
Sign up for free